Microsatellite

Only available on StudyMode
  • Topic: DNA, Genetics, Short tandem repeat
  • Pages : 5 (1229 words )
  • Download(s) : 75
  • Published : February 11, 2013
Open Document
Text Preview
POLYTECHNIC UNIVERSITY OF THE PHILIPPINES
Department of Biology
COLLEGE OF SCIENCE

A written report on

Monica Angelique Ramos
BS BIO 4-2
I. Definition
Microsatellites (also called simple sequence repeats or SSRs) are a class of genetic polymorphism commonly used for mapping, linkage analysis and to trace inheritance patterns. It is a specific sequence of DNA bases (nucleotides) made up of short segments of 1-6 bp repeated in more or less uniform tracts up to ~102 bp long. They are classified as mono, di, tri or tetra tandem repeats.

II. Background information
In 1989, it was studied in human and was found to be common in plants and animals.
Variation in the number of repeats in a microsatellite arises due to DNA-polymerase errors during the DNA replication process. During DNA replication, DNA-polymerase moves along a DNA sequence and adds complementary bases to the template strand. When this template is highly repetitive, as in a microsatellite sequence, the DNA-polymerase may "hiccup" and move forward or backward one full repeat before continuing replication. This process of gaining or losing a single repeat of a motif is called the stepwise mutation process. 

At a given microsatellite, different individuals can have different numbers of repeats. Changes in the number of repeats result from mutation. Microsatellites mutate very rapidly (100 -10,000 times faster than normal base pair substitutions), so there is lots of variation between individuals.

Individuals have two copies of every microsatellite (coming from each of the parents). The copies can be the same or different (homozygous or heterozygous).

III. Types
The types of microsatellites are:
* (A)n, (T)n, (C)n, (G)n – mononucleotide
* (AT)n, (CG)n, (GT)n – dinucleotide
* (ATT)n, (CCG)n, (GTA)n – trinucleotide
* (CCGG)n, (TATC)n – tetranucleotide
It can also be classified as:
Compound SSRs:
* ATATATATCACACAATATATATCACACA - (AT)4(CA)3
* CCGCCGATATATATCCGCCGATATATAT - (CCG)3(AT)4
Perfect SSR motifs:
* AAAAAAAAAAAA - (A)12
* ATATATATATATATATAT - (AT)9
* CCGCCGCCGCCGCCGCCGCCG - (CCG)7

Imperfect SSR motifs:
* AAAAATAAAAAAAA - (A)14
* ATATATATACATATATAT - (AT)9

IV. Limitations
A. Advantages
Microsatellites are very polymorphic because of their rapid mutation rate thus they can provide a lot of genetic information. Microsatellites are also useful because they are neutral markers (do not code for proteins) therefore selection should not interfere with our ability to infer population history. They are locus-specific (in contrast to multi-locus markers such as minisatellites or RAPDs), codominant (heterozygotes can be distinguished from homozygotes, in contrast to RAPDs and AFLPs), and PCR-based (means we need only tiny amounts of tissue; works on highly degraded or "ancient" DNA). Finally, microsatellites are relatively inexpensive to quantify, even in non-model organisms, so they can be applied to a wide variety of systems. B. Disadvantages

Microsatellites are limiting in that they sometimes violate the stepwise mutation process, a basic assumption for most population genetic analyses. Furthermore, since mutations can either add or remove tandem repeat units, homoplasy between alleles is possible, particularly when comparing distantly related groups.

V. How to detect it?
A. Amplification
After DNA isolation, the region containing the microsatellite is amplified by designing PCR primers that are unique to one locus in the genome and that base pair on either side of the repeated portion (figure 1). Therefore, a single pair of PCR primers will work for every individual in the species and produce different sized products for each of the different length microsatellites.

Figure 1. Detecting microsatellites from genomic DNA. Two PCR primers (forward and reverse gray arrows) are designed to flank the microsatellite...
tracking img