Microsatellite
POLYTECHNIC UNIVERSITY OF THE PHILIPPINES
Department of Biology
COLLEGE OF SCIENCE
A written report on
Monica Angelique Ramos
BS BIO 4-2 I. Definition Microsatellites (also called simple sequence repeats or SSRs) are a class of genetic polymorphism commonly used for mapping, linkage analysis and to trace inheritance patterns. It is a specific sequence of DNA bases (nucleotides) made up of short segments of 1-6 bp repeated in more or less uniform tracts up to ~102 bp long. They are classified as mono, di, tri or tetra tandem repeats.
II. Background information In 1989, it was studied in human and was found to be common in plants and animals. Variation in the number of repeats in a microsatellite arises due to DNA-polymerase errors during the DNA replication process. During DNA replication, DNA-polymerase moves along a DNA sequence and adds complementary bases to the template strand. When this template is highly repetitive, as in a microsatellite sequence, the DNA-polymerase may "hiccup" and move forward or backward one full repeat before continuing replication. This process of gaining or losing a single repeat of a motif is called the stepwise mutation process. At a given microsatellite, different individuals can have different numbers of repeats. Changes in the number of repeats result from mutation. Microsatellites mutate very rapidly (100 -10,000 times faster than normal base pair substitutions), so there is lots of variation between individuals. Individuals have two copies of every microsatellite (coming from each of the parents). The copies can be the same or different (homozygous or heterozygous).
III. Types The types of microsatellites are: * (A)n, (T)n, (C)n, (G)n – mononucleotide * (AT)n, (CG)n, (GT)n – dinucleotide * (ATT)n, (CCG)n, (GTA)n – trinucleotide * (CCGG)n, (TATC)n – tetranucleotide It can also be classified as:
Compound SSRs: * ATATATATCACACAATATATATCACACA - (AT)4(CA)3 *
Department of Biology
COLLEGE OF SCIENCE
A written report on
Monica Angelique Ramos
BS BIO 4-2 I. Definition Microsatellites (also called simple sequence repeats or SSRs) are a class of genetic polymorphism commonly used for mapping, linkage analysis and to trace inheritance patterns. It is a specific sequence of DNA bases (nucleotides) made up of short segments of 1-6 bp repeated in more or less uniform tracts up to ~102 bp long. They are classified as mono, di, tri or tetra tandem repeats.
II. Background information In 1989, it was studied in human and was found to be common in plants and animals. Variation in the number of repeats in a microsatellite arises due to DNA-polymerase errors during the DNA replication process. During DNA replication, DNA-polymerase moves along a DNA sequence and adds complementary bases to the template strand. When this template is highly repetitive, as in a microsatellite sequence, the DNA-polymerase may "hiccup" and move forward or backward one full repeat before continuing replication. This process of gaining or losing a single repeat of a motif is called the stepwise mutation process. At a given microsatellite, different individuals can have different numbers of repeats. Changes in the number of repeats result from mutation. Microsatellites mutate very rapidly (100 -10,000 times faster than normal base pair substitutions), so there is lots of variation between individuals. Individuals have two copies of every microsatellite (coming from each of the parents). The copies can be the same or different (homozygous or heterozygous).
III. Types The types of microsatellites are: * (A)n, (T)n, (C)n, (G)n – mononucleotide * (AT)n, (CG)n, (GT)n – dinucleotide * (ATT)n, (CCG)n, (GTA)n – trinucleotide * (CCGG)n, (TATC)n – tetranucleotide It can also be classified as:
Compound SSRs: * ATATATATCACACAATATATATCACACA - (AT)4(CA)3 *
References: * http://www.mindupbioresearch.com/biomarkers.html * http://www.uvm.edu/~cgep/Education/Microsatellite.html * http://www.lifesciences.sourcebioscience.com/genomic-services/faq/microsatellite-genotyping.aspx * http://webcache.googleusercontent.com/search?q=cache:OyYlove_wTwJ:www.woodrow.org/teachers/esi/2002/biology/projects/p3/definition.htm+microsatellite&cd * http://webcache.googleusercontent.com/search?q=cache:4ToTbo4xdo8J:en.wikipedia.org/wiki/Microsatellite+microsatellite&cd=1&hl=fil&ct=cln * http://villagedogs.canmap.org/tutorials/microLesson.aspx * http://www.bio.davidson.edu/courses/genomics/method/microsatellite.html * http://research.foxyresearch.com/microsat.htm