Dna Chip

Only available on StudyMode
  • Topic: DNA, Gene expression, DNA microarray
  • Pages : 22 (901 words )
  • Download(s) : 64
  • Published : January 1, 2013
Open Document
Text Preview
An Introduction to DNA microarrays
Rebecca Fry, Ph.D.

http://www.buffalo.edu/UBT/UBT

What is a DNA Microarray?
genes or gene fragments
attached to a substrate (glass)

Tens of thousands of spots

Hybridized slide
Two dyes
Image analyzed

1

The Beginnings of Microarray Technology

Lockhart et al., 1996
Nature Biotechnology
“Expression monitoring by hybridisation to high-density oligonucleotide arrays”

Schena et al., 1995
Science
“Quantitative monitoring of gene expression patterns with a complementary DNA microarray”

8 years later
4162 references

2

Uses and Applications

Target identification

Pathway mapping

Gene screening

Mechanism of Action Studies

Disease characterization

Molecular Diagnosis of Disease

Personalized medicine

Developmental Biology

Prediction of Drug Efficacy/Toxicity

Toxicology

A model experiment:
Two samples of interest
EGFP expressing cells

EGFP KD

Differential
Gene
Expression?!

http://www.oardc.ohio-state.edu/plantranslab/gfp-a.gif

Q: Which genes are differentially expressed
in EGFP cells versus EGFP KD cells?

3

Process of transcribing
deoxyribonucleic acid to
ribonucleic acid is
“TRANSCRIPTION”

RNA

Nucleic acids
must be translated into
amino acids that make
up proteins
Process:
“TRANSLATION”

DNA

Cell

nucleus

Protein
cytoplasm

Chem.ox.ac.uk

Inside every cell: DNA
Serves as a genetic blueprint

Dna molecule: berkeley.edu

Relating Gene Expression

DNA

RNA

Protein

High throughput protein assays
complicated
We measure transcript level

Is a gene expressed?
Is protein produced
Ideally measure protein
levels

4

Introduction
Two Popular Microarraying Platforms
Spotted microarrays

Commercially available microarray

www.molgen.mpg.de

cDNA: PCR products
(500-2,000bp)
synthesized oligos
>10,000 probes

www.the-scientist.com

Affymetrix
“Gene Chip”
500,000 probes
25 mer (represents a fragment of a gene)

Designing Oligos
846

1
EGFP ORF
ATTCTGCAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCACCAT
GGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCG
AGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGC
GAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACC
GGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGG
CGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTT
CAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAA
GGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACA
CCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCA
ACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATAT
CATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCA
CAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACAC
CCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCAC
CCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCT
GCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTA
CAAGAAGCTTAGCCATGGCTTCCCGCCGGCGGTGGCGGCGCAGGATGATG
GCACGCTGCCCATGTCTTGTGCCCAGGAGAGCGGGATGGACCGTCACCCTG
CAGCCTGTGCTTCTGCTAGGATCAATGTGTAGGCGGCCGCGACTCTAGATC
ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCC
ACACCTCCCCCTGA

70 mer oligo
specific to gene
of interest

5

Introduction
Overview of fabrication of spotted microarrays
Spotted microarrays
Robotics: Liquid Handling
Resuspension of oligos

www.qiageninstruments.com

www.biorobotics.com

Robotic Printing

ABH

BTG1
alkB homolog

DMC1

ABH2

CASP2

ABH3

CASP3

EGFP

ADPRT

CASP8

ENDOG

ADPRTL2

CASP9

ERCC1

ADPRTL3

CCNH

DUT

ERCC2

APEX

CDK2

ERCC3

APEXL2

CDK4

ERCC4

ATM

CDK6

ERCC5

ATR

CDK7

EXO1

BID

CDK8

FANCA

BLM
BRCA1
BRCA2

CETN2

FANCC

Breast cancer 1 FANCE
DCLRE1A
DDB1

FANCF

G22P1

POLQ
Growth arrest and DNA-damage-inducible

GADD45A
GADD45B
GADD45G
GTF2H4

Excision repair
HAP1
HCNP
HSU24186

PRKDC
PRSS25
RAD1
RAD17
RAD18
RAD23A
RAD23B

HUS1

RAD50

JUN

RAD51

LIG1

RAD51C

LIG3

RAD51L1

LIG4...
tracking img