Biol 202 Notes

Only available on StudyMode
  • Topic: DNA, RNA, Gene
  • Pages : 7 (863 words )
  • Download(s) : 69
  • Published : March 24, 2013
Open Document
Text Preview
Transcription

The Central Dogma
RNA Polymerase Ribosome

DNA
transcription replication

RNA
translation

Protein

One gene encodes one protein? (Beadle and Tatum, 1941)
•  •  •  Cellular machinery is largely made up of proteins. Proteins are made up of chains or sequences of amino acids. The sequence of these amino acids are "encoded" in the cell's DNA. DNA is transcribed into RNA, which is then translated into protein. When one gene is mutated, one protein is affected (usually disabled). But, the analysis of human genome (and many “higher” eukaryotes) suggests that in general, multiple proteins arise from each gene in humans as a result of alternative splicing (will discuss in later lecture).

•  • 

Differences Between RNA and DNA
•  RNA contains ribose, rather than deoxyribose (difference of a single oxygen). •  RNA uses uracil rather than thymidine as a base; Uracil still base pairs with adenine. • RNA is generally single stranded, rather than double stranded and thus is capable of folding into complex three-dimensional shapes.

Differences between RNA and DNA building blocks
5’

P
4’ 3’ 2’ 1’

P

Phosphate linkage here

(RNA)

Phosphate linkage here

(DNA)

•  Like DNA, RNA has POLARITY (5’ and 3’) •  Unlike DNA, RNA is usually single-stranded and flexible

5ʹ′ and 3ʹ′ refer to the carbon positions on the sugar ring of RNA or DNA

5’ 4’ 1’ 3’ 2’

This hydroxyl group is required for RNA polymerization

RNA contains a different base → Uracil
O H 3C C C H
5 6 1

O H
3 2

C
4

H C C
5 6

C
4 3 2 1

H N C O

N C O H

N H

N H

thymine (T)

uracil (U)

RNAs can fold into unique structures

tRNAs are highly specialized RNAs that function during translation

tRNA secondary structure

tRNA tertiary structure

RNA secondary structures can be very complex

16S Ribosomal RNA secondary structure

Two kinds of RNA
•  Messenger RNA (= mRNA; translated into proteins). •  Structural (functional) RNAs – not translated. – includes: •  ribosomal RNA (rRNA, which is an integral component of ribosomes) •  transfer RNA (tRNAs which are involved in translation) •  small nuclear RNAs (snRNAs, involved in RNA splicing) •  cytoplasmic RNAs (scRNAs involved in protein trafficking) •  microRNA, siRNAs, piRNAs (regulate the expression of genes)

Transcription
•  Catalyzed by RNA polymerase – a complex, multisubunit enzyme that catalyzes the formation of the phosphodiester bonds that link together the nucleotides in an RNA chain

Gene Structure
“upstream” “downstream”

Transcription Transcription start site Translation stop site

5’(CAP)

AUG

TAA

(AAAA) 3’UTR

5’UTR Translation start site

Note: 5’ CAP, poly A tail and intron only present in eukaryotes UTR = untranslated region.

Gene can be transcribed from either strand of DNA

RNA is always synthesized 5’ to 3’
(coding strand)

Therefore, the template strand is read 3’ to 5’

Transcription
5’ GATCTGACTGACATAGACATAGAT 3’ coding (= non-template) strand 3’ CTAGACTGACTGTATCTGTATCTA 5’ template strand 5’ GAUCUGACUGACAUAGACAUAGAU 3’ mRNA

E. coli promoters contain characteristic DNA sequences that associate with sigma factors and RNA Polymerase holoenzyme

Pribnow box

Mutations in -10 and -35 sequences affect transcription

DNA complexed with RNA polymerase

In both prokaryotes and eukaryotes, transcription proceeds in stages called Initiation, Elongation, and Termination Sigma factor

Prokaryotic Transcriptional Initiation

Comparison of Regulation of Gene Expression Between Prokaryotes and Eukaryotes Prokaryotes
•  Control of transcription through specific DNA-binding proteins •  Role played by chromatin structure •  Coordination achieved by operons •  Differential splicing •  Attenuation •  Differential polyadenylation •  Differential transport from nucleus to cytoplasm •  Differential rates of translation

Eukaryotes Yes Yes No Yes No Yes...
tracking img